genetics

| December 7, 2015

5 GTCACTTATAAAGCGGTATTTCGCGTTGTAACGTGCGCATCATGATCGCGCCAGTCGCCACCATGTACTTTGCCGTCT 3
3 CAGTGAATATTTCGCCATAAAGCGCAACATTGCACGCGTAGTACTAGCGCGGTCAGCGGTGGTACATGAAACGGCAGA 5
5 (cont.) GCCTAGCAAGCAGTATCAGCGGGGAGAATGAAACCATCTGTAGTTAACGGGTATTTCGATTTAAAAAAGTC 3
3 (cont.) CGGATCGTTCGTCATAGTCGCCCCTCTTACTTTGGTAGACATCAATTGCCCATAAAGCTAAATTTTTTCAG 5
Above is shown a dsDNA sequence that includes the ORF encoding for a short protein. The TSS is
shaded.
1) Transcribe the correct mRNA (assume there is no termination site). Label the 5 and 3 ends.
2) Translate the mRNA into the encoded protein. Label the N and C termini

Get a 20 % discount on an order above $ 120
Use the following coupon code :
today2015

Category: Biology

Order a customized paper today!