genetics

| December 8, 2015

About Gene Cloning – EMERGENCY :(!!

Hello I have to write a report about the experiment I did about gene cloning and also have to answer few qns from the prof. I woud really appreciate if anybody can help me and will thank you in a possible way. I am that desperate since this would be very important for my grade 🙁

I don’t know the insert gene and have to figure it out on NCBI BLAST search using the sequence.( I tried but I couldnt find on NCBI)

The cloning was with pGEX-4T-1 vector and unknown gene which is about 700bp.

It says by using pGEX_3_primer, got the sequence, which would be reverse sequnece so I did reverse and it is

AAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCA

TGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGG

ATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCA

AGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGA

GGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTC

AGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCG

AGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCT

GCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAA

GAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAG

CAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT

GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAA

CAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCGGCCGC

Then the qn is,

1.What is this gene? Where is the start and stop codon of this gene coding sequence?

2.Would this gene translated in in-frame? Gst fusion?

3.What is the partial expected amino acid sequence of GST-YFP protien?

4.Can you find the restriction enzyme site that we used? (BamHI, NotI)

5.To check weather the cloning was done or not, it is better to use one restriction enzyme that is on vector and the other is on insert. In this case we used the same emzyme as we used for cloning which are BamHI and NotI. If we want to still use NotI but change BamHI as different enzyme, what could it be?

Get a 20 % discount on an order above $ 120
Use the following coupon code :
today2015

Category: Biology

Order a customized paper today!